RNA-pdb-tools

You need to install rna-pdb-tools (http://rna-pdb-tools.readthedocs.io/en/latest/) first.

Draw VARNA-based image of RNA secondary structure

Type:

<pre>[ss:rna]
UUUCUGUAUAAUGCCGAUAAUAAGGUUCGGCAGUUUCUACCAAACAGCCGUAAACUGUUUGACUACAGUAA
((.(((((...((((((.........))))))........(((((((.......)))))))..))))).))
</pre>

Warning

Keep exactly the same syntax as in the example above and below.

The syntax:

<pre>
[ss:/name of your seq/]
/seq/
/ss/
</pre>
# ^ not <pre/> nor <pre>. Keep a new line after this syntax. So don't do:
</pre>
<pre>

but

</pre>

<pre>
# ^ this could be fixed at some point

Warning

This plugin will change your Markdown file, so make sure that your editor will detect this change and ask you to reload the file!

engine.plugins.draw_secondary_structure.get_ss(text)[source]

Draw secondary structure using VARNA.

Warning

to each image ss_ is added at the beginning of the image file

1. if the line after </pre> has ![ it means that there is an image already, don’t generate new one. And of course, it means if you remove this line, the image will be regenerated.

  1. if [!danger] also skip generation images.

Should I overwrite a file ? By default no! Use [ss:file:t] # to set overwrite to true

to get a VARNA-drawn image of secondary structure.

_images/XQxIC1CrCP.gif